Redirect to homepage if error occurs

5 years ago · 4846f0c44f
4 changed files with 9 additions and 13 deletions
--- a/src/lib.rs
+++ b/src/lib.rs
@ -16,7 +16,6 @@ extern {
    fn alert(s: &str);
 }

-//#[wasm_bindgen]
 pub fn transcription(dna: String) -> String {
    let char_vec: Vec<char> = dna.chars().collect();
    let mut transcribed_vec: Vec<char> = Vec::new();
@ -28,7 +27,6 @@ pub fn transcription(dna: String) -> String {
            'C' => transcribed_vec.push('G'),
            'G' => transcribed_vec.push('C'),
            _ => {
-                // println!("Incorrect char");
                break;
             }
        }
@ -38,7 +36,6 @@ pub fn transcription(dna: String) -> String {
    return transcribed_string;
 }

-//#[wasm_bindgen]
 pub fn find_start(messenger_rna: String) -> String {
    let start_codon = "AUG";
    let start_index = messenger_rna.find(start_codon).unwrap();
@ -46,7 +43,6 @@ pub fn find_start(messenger_rna: String) -> String {
    return inter_rna;
 }

-//#[wasm_bindgen]
 pub fn break_into_codons(inter_rna: String) -> Vec<String> {
    let sub_len = 3;
    let subs = inter_rna.as_bytes()
@ -63,7 +59,6 @@ pub fn break_into_codons(inter_rna: String) -> Vec<String> {
    return string_vec;
 }

-//#[wasm_bindgen]
 pub fn find_stop(inter_codons: &[String]) -> usize {
    let mut stop_index_1: usize = usize::MAX;
    let mut stop_index_2: usize = usize::MAX;
@ -84,7 +79,6 @@ pub fn find_stop(inter_codons: &[String]) -> usize {
    return stop_index;
 }

-//#[wasm_bindgen]
 pub fn find_first(stop_index_1: usize, stop_index_2: usize, stop_index_3: usize) -> usize {
    let mut stop_index: usize = 1;

@ -114,7 +108,6 @@ pub fn find_first(stop_index_1: usize, stop_index_2: usize, stop_index_3: usize)
    return stop_index;
 }

-//#[wasm_bindgen]
 pub fn translation(inter_codons: Vec<String>) -> Vec<String> {
    let mut amino_acids_list: Vec<String> = Vec::new();

@ -143,7 +136,6 @@ pub fn translation(inter_codons: Vec<String>) -> Vec<String> {
             "AAU" | "AAC" => amino_acids_list.push("Asparginine".to_string()),
             "AAA" | "AAG" => amino_acids_list.push("Lysine".to_string()),
             _ => {
-                // println!("Incorrect char");
                break;
             }
        }
@ -156,7 +148,6 @@ pub fn translation(inter_codons: Vec<String>) -> Vec<String> {
 pub fn main(mut strand: String) {
    println!("Enter the DNA strand to be transcribed and translated: ");

-    //let mut strand: String = "TACATGCCATACGAGACGAGCGCGCCTAAGCGGCGCAGACTCATGGTCATT".to_string();
    strand = strand.to_string().to_uppercase();

    let messenger_rna = transcription(strand);
--- a/www/app.html
+++ b/www/app.html
@ -7,6 +7,6 @@
  <body>
    <noscript>This page contains webassembly and javascript content, please enable javascript in your browser.</noscript>
    <script src="./bootstrap.js"></script>
-    <h1>Hello</h1>
+    <h1>DNA Transcription &amp; Translation</h1>
  </body>
 </html>
--- a/www/app.js
+++ b/www/app.js
@ -3,6 +3,9 @@ import * as wasm from "wasm-dna-transcription-translation";
 const urlParams = new URLSearchParams(window.location.search);
 const strand = urlParams.get('strand');

-console.log(strand)
-
+try {
  wasm.main(strand);
+} catch(err) {
+   alert('Oh no! Something went wrong. Please check that your DNA strand only uses valid characters, and has a stop & start codon. You will now be redirected to the homepage.')
+   window.location.href = '/';
+}
--- a/www/webpack.config.js
+++ b/www/webpack.config.js
@ -2,6 +2,7 @@ const CopyWebpackPlugin = require("copy-webpack-plugin");
 const path = require('path');

 module.exports = {
+  devtool: 'eval-source-map',
  entry: "./bootstrap.js",
  output: {
    path: path.resolve(__dirname, "dist"),
@ -10,5 +11,6 @@ module.exports = {
  mode: "development",
  plugins: [
    new CopyWebpackPlugin(['index.html'])
+    new CopyWebpackPlugin(['app.html'])
  ],
 };