A simple, fast program which transcribes a DNA strand into messenger RNA (mRNA), which it then translates into amino acids, implemented in Rust.
You can not select more than 25 topics Topics must start with a letter or number, can include dashes ('-') and can be up to 35 characters long.

163 lines
5.6 KiB

#[cfg(test)]
use std::io;
use std::str;
use std::process;
fn transcription(dna: String) -> String {
let char_vec: Vec<char> = dna.chars().collect();
let mut transcribed_vec: Vec<char> = Vec::new();
for i in char_vec {
match i {
'A' => transcribed_vec.push('U'),
'T' => transcribed_vec.push('A'),
'C' => transcribed_vec.push('G'),
'G' => transcribed_vec.push('C'),
_ => {
// println!("Incorrect char");
break;
}
}
}
let transcribed_string: String = transcribed_vec.into_iter().collect();
return transcribed_string;
}
fn find_start(messenger_rna: String) -> String {
let start_codon = "AUG";
let start_index = messenger_rna.find(start_codon).unwrap();
let inter_rna: String = messenger_rna.chars().skip(start_index).collect();
return inter_rna;
}
fn break_into_codons(inter_rna: String) -> Vec<String> {
let sub_len = 3;
let subs = inter_rna.as_bytes()
.chunks(sub_len)
.map(str::from_utf8)
.collect::<Result<Vec<&str>, _>>()
.unwrap();
let mut string_vec: Vec<String> = Vec::new();
for i in &subs {
string_vec.push(i.to_string());
}
return string_vec;
}
fn find_stop(inter_codons: &[String]) -> usize {
let mut stop_index_1: usize = usize::MAX;
let mut stop_index_2: usize = usize::MAX;
let mut stop_index_3: usize = usize::MAX;
if inter_codons.iter().any(|i| i == "UAA") {
stop_index_1 = inter_codons.iter().position(|r| r == "UAA").unwrap();
}
if inter_codons.iter().any(|i| i == "UAG") {
stop_index_2 = inter_codons.iter().position(|r| r == "UAG").unwrap();
}
if inter_codons.iter().any(|i| i == "UGA") {
stop_index_3 = inter_codons.iter().position(|r| r == "UGA").unwrap();
}
let stop_index = find_first(stop_index_1, stop_index_2, stop_index_3);
return stop_index;
}
fn find_first(stop_index_1: usize, stop_index_2: usize, stop_index_3: usize) -> usize {
let mut stop_index: usize = 1;
if stop_index_1 < stop_index_2 {
if stop_index_1 < stop_index_3{
println!("UAA stop codon found!");
stop_index = stop_index_1;
}
}
else if stop_index_2 < stop_index_1 {
if stop_index_2 < stop_index_3 {
println!("UAG stop codon found!");
stop_index = stop_index_2;
}
}
else if stop_index_3 < stop_index_1 {
if stop_index_3 < stop_index_2 {
println!("UGA stop codon found!");
stop_index = stop_index_3;
}
}
else {
println!("No stop codon found!");
process::exit(1);
}
return stop_index;
}
fn translation(inter_codons: Vec<String>) -> Vec<String> {
let mut amino_acids_list: Vec<String> = Vec::new();
for i in inter_codons {
match i.as_str() {
"GUU" | "GUC" | "GUA" | "GUG" => amino_acids_list.push("Valine".to_string()),
"GCU" | "GCC" | "GCA" | "GCG" => amino_acids_list.push("Alanine".to_string()),
"GAU" | "GAC" => amino_acids_list.push("Aspartic Acid".to_string()),
"GAA" | "GAG" => amino_acids_list.push("Glutamic Acid".to_string()),
"GGU" | "GGC" | "GGA" | "GGG" => amino_acids_list.push("Glycine".to_string()),
"UUU" | "UUC" => amino_acids_list.push("Phenylalanine".to_string()),
"UUA" | "UUG" | "CUU" | "CUC" | "CUA" | "CUG" => amino_acids_list.push("Leucine".to_string()),
"UCU" | "UCC" | "UCA" | "UCG" | "AGU" | "AGC" => amino_acids_list.push("Serine".to_string()),
"UAU" | "UAC" => amino_acids_list.push("Tyrosine".to_string()),
"UAA" | "UAG" => amino_acids_list.push("STOP".to_string()),
"UGU" | "UGC" => amino_acids_list.push("Cysteine".to_string()),
"UGA" => amino_acids_list.push("STOP".to_string()),
"UGG" => amino_acids_list.push("Tryptophan".to_string()),
"CCU" | "CCC" | "CCA" | "CCG" => amino_acids_list.push("Proline".to_string()),
"CAU" | "CAC" => amino_acids_list.push("Histidine".to_string()),
"CAA" | "CAG" => amino_acids_list.push("Glutamine".to_string()),
"CGU" | "CGC" | "CGA" | "CGG" | "AGA" | "AGG" => amino_acids_list.push("Arginine".to_string()),
"AUU" | "AUC" | "AUA" => amino_acids_list.push("Isoleucine".to_string()),
"AUG" => amino_acids_list.push("Methionine".to_string()),
"ACU" | "ACC" | "ACA" | "ACG" => amino_acids_list.push("Threonine".to_string()),
"AAU" | "AAC" => amino_acids_list.push("Asparginine".to_string()),
"AAA" | "AAG" => amino_acids_list.push("Lysine".to_string()),
_ => {
// println!("Incorrect char");
break;
}
}
}
return amino_acids_list;
}
fn test() {
println!("Enter the DNA strand to be transcribed and translated: ");
let mut strand: String = "TACATGCCATACGAGACGAGCGCGCCTAAGCGGCGCAGACTCATGGTCATT".to_string();
strand = strand.to_uppercase();
let messenger_rna = transcription(strand);
println!("The transcribed strand is: {}", messenger_rna);
let inter_rna = find_start(messenger_rna);
println!("{}", inter_rna);
let mut inter_codons = break_into_codons(inter_rna);
let mut stop_index = find_stop(&inter_codons);
stop_index = stop_index + 1;
println!("{}", stop_index);
inter_codons.truncate(stop_index);
let amino_acids_list = translation(inter_codons);
print!("The translated amino acids are: ");
for i in amino_acids_list {
print!("{}, ", i);
}
}
#[test]
fn main() {
test();
}