#[cfg(test)] use std::io; use std::str; use std::process; fn transcription(dna: String) -> String { let char_vec: Vec = dna.chars().collect(); let mut transcribed_vec: Vec = Vec::new(); for i in char_vec { match i { 'A' => transcribed_vec.push('U'), 'T' => transcribed_vec.push('A'), 'C' => transcribed_vec.push('G'), 'G' => transcribed_vec.push('C'), _ => { // println!("Incorrect char"); break; } } } let transcribed_string: String = transcribed_vec.into_iter().collect(); return transcribed_string; } fn find_start(messenger_rna: String) -> String { let start_codon = "AUG"; let start_index = messenger_rna.find(start_codon).unwrap(); let inter_rna: String = messenger_rna.chars().skip(start_index).collect(); return inter_rna; } fn break_into_codons(inter_rna: String) -> Vec { let sub_len = 3; let subs = inter_rna.as_bytes() .chunks(sub_len) .map(str::from_utf8) .collect::, _>>() .unwrap(); let mut string_vec: Vec = Vec::new(); for i in &subs { string_vec.push(i.to_string()); } return string_vec; } fn find_stop(inter_codons: &[String]) -> usize { let mut stop_index_1: usize = usize::MAX; let mut stop_index_2: usize = usize::MAX; let mut stop_index_3: usize = usize::MAX; if inter_codons.iter().any(|i| i == "UAA") { stop_index_1 = inter_codons.iter().position(|r| r == "UAA").unwrap(); } if inter_codons.iter().any(|i| i == "UAG") { stop_index_2 = inter_codons.iter().position(|r| r == "UAG").unwrap(); } if inter_codons.iter().any(|i| i == "UGA") { stop_index_3 = inter_codons.iter().position(|r| r == "UGA").unwrap(); } let stop_index = find_first(stop_index_1, stop_index_2, stop_index_3); return stop_index; } fn find_first(stop_index_1: usize, stop_index_2: usize, stop_index_3: usize) -> usize { let mut stop_index: usize = 1; if stop_index_1 < stop_index_2 { if stop_index_1 < stop_index_3{ println!("UAA stop codon found!"); stop_index = stop_index_1; } } else if stop_index_2 < stop_index_1 { if stop_index_2 < stop_index_3 { println!("UAG stop codon found!"); stop_index = stop_index_2; } } else if stop_index_3 < stop_index_1 { if stop_index_3 < stop_index_2 { println!("UGA stop codon found!"); stop_index = stop_index_3; } } else { println!("No stop codon found!"); process::exit(1); } return stop_index; } fn translation(inter_codons: Vec) -> Vec { let mut amino_acids_list: Vec = Vec::new(); for i in inter_codons { match i.as_str() { "GUU" | "GUC" | "GUA" | "GUG" => amino_acids_list.push("Valine".to_string()), "GCU" | "GCC" | "GCA" | "GCG" => amino_acids_list.push("Alanine".to_string()), "GAU" | "GAC" => amino_acids_list.push("Aspartic Acid".to_string()), "GAA" | "GAG" => amino_acids_list.push("Glutamic Acid".to_string()), "GGU" | "GGC" | "GGA" | "GGG" => amino_acids_list.push("Glycine".to_string()), "UUU" | "UUC" => amino_acids_list.push("Phenylalanine".to_string()), "UUA" | "UUG" | "CUU" | "CUC" | "CUA" | "CUG" => amino_acids_list.push("Leucine".to_string()), "UCU" | "UCC" | "UCA" | "UCG" | "AGU" | "AGC" => amino_acids_list.push("Serine".to_string()), "UAU" | "UAC" => amino_acids_list.push("Tyrosine".to_string()), "UAA" | "UAG" => amino_acids_list.push("STOP".to_string()), "UGU" | "UGC" => amino_acids_list.push("Cysteine".to_string()), "UGA" => amino_acids_list.push("STOP".to_string()), "UGG" => amino_acids_list.push("Tryptophan".to_string()), "CCU" | "CCC" | "CCA" | "CCG" => amino_acids_list.push("Proline".to_string()), "CAU" | "CAC" => amino_acids_list.push("Histidine".to_string()), "CAA" | "CAG" => amino_acids_list.push("Glutamine".to_string()), "CGU" | "CGC" | "CGA" | "CGG" | "AGA" | "AGG" => amino_acids_list.push("Arginine".to_string()), "AUU" | "AUC" | "AUA" => amino_acids_list.push("Isoleucine".to_string()), "AUG" => amino_acids_list.push("Methionine".to_string()), "ACU" | "ACC" | "ACA" | "ACG" => amino_acids_list.push("Threonine".to_string()), "AAU" | "AAC" => amino_acids_list.push("Asparginine".to_string()), "AAA" | "AAG" => amino_acids_list.push("Lysine".to_string()), _ => { // println!("Incorrect char"); break; } } } return amino_acids_list; } fn test() { println!("Enter the DNA strand to be transcribed and translated: "); let mut strand: String = "TACATGCCATACGAGACGAGCGCGCCTAAGCGGCGCAGACTCATGGTCATT".to_string(); strand = strand.to_uppercase(); let messenger_rna = transcription(strand); println!("The transcribed strand is: {}", messenger_rna); let inter_rna = find_start(messenger_rna); println!("{}", inter_rna); let mut inter_codons = break_into_codons(inter_rna); let mut stop_index = find_stop(&inter_codons); stop_index = stop_index + 1; println!("{}", stop_index); inter_codons.truncate(stop_index); let amino_acids_list = translation(inter_codons); print!("The translated amino acids are: "); for i in amino_acids_list { print!("{}, ", i); } } #[test] fn main() { test(); }