diff --git a/LICENSE_APACHE b/LICENSE_APACHE deleted file mode 100644 index 1b5ec8b..0000000 --- a/LICENSE_APACHE +++ /dev/null @@ -1,176 +0,0 @@ - Apache License - Version 2.0, January 2004 - http://www.apache.org/licenses/ - -TERMS AND CONDITIONS FOR USE, REPRODUCTION, AND DISTRIBUTION - -1. Definitions. - - "License" shall mean the terms and conditions for use, reproduction, - and distribution as defined by Sections 1 through 9 of this document. - - "Licensor" shall mean the copyright owner or entity authorized by - the copyright owner that is granting the License. - - "Legal Entity" shall mean the union of the acting entity and all - other entities that control, are controlled by, or are under common - control with that entity. For the purposes of this definition, - "control" means (i) the power, direct or indirect, to cause the - direction or management of such entity, whether by contract or - otherwise, or (ii) ownership of fifty percent (50%) or more of the - outstanding shares, or (iii) beneficial ownership of such entity. - - "You" (or "Your") shall mean an individual or Legal Entity - exercising permissions granted by this License. - - "Source" form shall mean the preferred form for making modifications, - including but not limited to software source code, documentation - source, and configuration files. - - "Object" form shall mean any form resulting from mechanical - transformation or translation of a Source form, including but - not limited to compiled object code, generated documentation, - and conversions to other media types. - - "Work" shall mean the work of authorship, whether in Source or - Object form, made available under the License, as indicated by a - copyright notice that is included in or attached to the work - (an example is provided in the Appendix below). - - "Derivative Works" shall mean any work, whether in Source or Object - form, that is based on (or derived from) the Work and for which the - editorial revisions, annotations, elaborations, or other modifications - represent, as a whole, an original work of authorship. For the purposes - of this License, Derivative Works shall not include works that remain - separable from, or merely link (or bind by name) to the interfaces of, - the Work and Derivative Works thereof. - - "Contribution" shall mean any work of authorship, including - the original version of the Work and any modifications or additions - to that Work or Derivative Works thereof, that is intentionally - submitted to Licensor for inclusion in the Work by the copyright owner - or by an individual or Legal Entity authorized to submit on behalf of - the copyright owner. For the purposes of this definition, "submitted" - means any form of electronic, verbal, or written communication sent - to the Licensor or its representatives, including but not limited to - communication on electronic mailing lists, source code control systems, - and issue tracking systems that are managed by, or on behalf of, the - Licensor for the purpose of discussing and improving the Work, but - excluding communication that is conspicuously marked or otherwise - designated in writing by the copyright owner as "Not a Contribution." - - "Contributor" shall mean Licensor and any individual or Legal Entity - on behalf of whom a Contribution has been received by Licensor and - subsequently incorporated within the Work. - -2. Grant of Copyright License. Subject to the terms and conditions of - this License, each Contributor hereby grants to You a perpetual, - worldwide, non-exclusive, no-charge, royalty-free, irrevocable - copyright license to reproduce, prepare Derivative Works of, - publicly display, publicly perform, sublicense, and distribute the - Work and such Derivative Works in Source or Object form. - -3. Grant of Patent License. Subject to the terms and conditions of - this License, each Contributor hereby grants to You a perpetual, - worldwide, non-exclusive, no-charge, royalty-free, irrevocable - (except as stated in this section) patent license to make, have made, - use, offer to sell, sell, import, and otherwise transfer the Work, - where such license applies only to those patent claims licensable - by such Contributor that are necessarily infringed by their - Contribution(s) alone or by combination of their Contribution(s) - with the Work to which such Contribution(s) was submitted. If You - institute patent litigation against any entity (including a - cross-claim or counterclaim in a lawsuit) alleging that the Work - or a Contribution incorporated within the Work constitutes direct - or contributory patent infringement, then any patent licenses - granted to You under this License for that Work shall terminate - as of the date such litigation is filed. - -4. Redistribution. You may reproduce and distribute copies of the - Work or Derivative Works thereof in any medium, with or without - modifications, and in Source or Object form, provided that You - meet the following conditions: - - (a) You must give any other recipients of the Work or - Derivative Works a copy of this License; and - - (b) You must cause any modified files to carry prominent notices - stating that You changed the files; and - - (c) You must retain, in the Source form of any Derivative Works - that You distribute, all copyright, patent, trademark, and - attribution notices from the Source form of the Work, - excluding those notices that do not pertain to any part of - the Derivative Works; and - - (d) If the Work includes a "NOTICE" text file as part of its - distribution, then any Derivative Works that You distribute must - include a readable copy of the attribution notices contained - within such NOTICE file, excluding those notices that do not - pertain to any part of the Derivative Works, in at least one - of the following places: within a NOTICE text file distributed - as part of the Derivative Works; within the Source form or - documentation, if provided along with the Derivative Works; or, - within a display generated by the Derivative Works, if and - wherever such third-party notices normally appear. The contents - of the NOTICE file are for informational purposes only and - do not modify the License. You may add Your own attribution - notices within Derivative Works that You distribute, alongside - or as an addendum to the NOTICE text from the Work, provided - that such additional attribution notices cannot be construed - as modifying the License. - - You may add Your own copyright statement to Your modifications and - may provide additional or different license terms and conditions - for use, reproduction, or distribution of Your modifications, or - for any such Derivative Works as a whole, provided Your use, - reproduction, and distribution of the Work otherwise complies with - the conditions stated in this License. - -5. Submission of Contributions. Unless You explicitly state otherwise, - any Contribution intentionally submitted for inclusion in the Work - by You to the Licensor shall be under the terms and conditions of - this License, without any additional terms or conditions. - Notwithstanding the above, nothing herein shall supersede or modify - the terms of any separate license agreement you may have executed - with Licensor regarding such Contributions. - -6. Trademarks. This License does not grant permission to use the trade - names, trademarks, service marks, or product names of the Licensor, - except as required for reasonable and customary use in describing the - origin of the Work and reproducing the content of the NOTICE file. - -7. Disclaimer of Warranty. Unless required by applicable law or - agreed to in writing, Licensor provides the Work (and each - Contributor provides its Contributions) on an "AS IS" BASIS, - WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or - implied, including, without limitation, any warranties or conditions - of TITLE, NON-INFRINGEMENT, MERCHANTABILITY, or FITNESS FOR A - PARTICULAR PURPOSE. You are solely responsible for determining the - appropriateness of using or redistributing the Work and assume any - risks associated with Your exercise of permissions under this License. - -8. Limitation of Liability. In no event and under no legal theory, - whether in tort (including negligence), contract, or otherwise, - unless required by applicable law (such as deliberate and grossly - negligent acts) or agreed to in writing, shall any Contributor be - liable to You for damages, including any direct, indirect, special, - incidental, or consequential damages of any character arising as a - result of this License or out of the use or inability to use the - Work (including but not limited to damages for loss of goodwill, - work stoppage, computer failure or malfunction, or any and all - other commercial damages or losses), even if such Contributor - has been advised of the possibility of such damages. - -9. Accepting Warranty or Additional Liability. While redistributing - the Work or Derivative Works thereof, You may choose to offer, - and charge a fee for, acceptance of support, warranty, indemnity, - or other liability obligations and/or rights consistent with this - License. However, in accepting such obligations, You may act only - on Your own behalf and on Your sole responsibility, not on behalf - of any other Contributor, and only if You agree to indemnify, - defend, and hold each Contributor harmless for any liability - incurred by, or claims asserted against, such Contributor by reason - of your accepting any such warranty or additional liability. - -END OF TERMS AND CONDITIONS diff --git a/LICENSE_MIT b/LICENSE_MIT deleted file mode 100644 index 9df422f..0000000 --- a/LICENSE_MIT +++ /dev/null @@ -1,25 +0,0 @@ -Copyright (c) 2018 rav4s - -Permission is hereby granted, free of charge, to any -person obtaining a copy of this software and associated -documentation files (the "Software"), to deal in the -Software without restriction, including without -limitation the rights to use, copy, modify, merge, -publish, distribute, sublicense, and/or sell copies of -the Software, and to permit persons to whom the Software -is furnished to do so, subject to the following -conditions: - -The above copyright notice and this permission notice -shall be included in all copies or substantial portions -of the Software. - -THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF -ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED -TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A -PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT -SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY -CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION -OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR -IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER -DEALINGS IN THE SOFTWARE. diff --git a/src/lib.rs b/src/lib.rs index de51ec4..08e6795 100644 --- a/src/lib.rs +++ b/src/lib.rs @@ -1,6 +1,9 @@ mod utils; use wasm_bindgen::prelude::*; +use std::io; +use std::str; +use std::process; // When the `wee_alloc` feature is enabled, use `wee_alloc` as the global // allocator. @@ -13,7 +16,162 @@ extern { fn alert(s: &str); } +//#[wasm_bindgen] +pub fn transcription(dna: String) -> String { + let char_vec: Vec = dna.chars().collect(); + let mut transcribed_vec: Vec = Vec::new(); + for i in char_vec { + + match i { + 'A' => transcribed_vec.push('U'), + 'T' => transcribed_vec.push('A'), + 'C' => transcribed_vec.push('G'), + 'G' => transcribed_vec.push('C'), + _ => { + // println!("Incorrect char"); + break; + } + } + } + + let transcribed_string: String = transcribed_vec.into_iter().collect(); + return transcribed_string; +} + +//#[wasm_bindgen] +pub fn find_start(messenger_rna: String) -> String { + let start_codon = "AUG"; + let start_index = messenger_rna.find(start_codon).unwrap(); + let inter_rna: String = messenger_rna.chars().skip(start_index).collect(); + return inter_rna; +} + +//#[wasm_bindgen] +pub fn break_into_codons(inter_rna: String) -> Vec { + let sub_len = 3; + let subs = inter_rna.as_bytes() + .chunks(sub_len) + .map(str::from_utf8) + .collect::, _>>() + .unwrap(); + + let mut string_vec: Vec = Vec::new(); + for i in &subs { + string_vec.push(i.to_string()); + } + + return string_vec; +} + +//#[wasm_bindgen] +pub fn find_stop(inter_codons: &[String]) -> usize { + let mut stop_index_1: usize = usize::MAX; + let mut stop_index_2: usize = usize::MAX; + let mut stop_index_3: usize = usize::MAX; + + if inter_codons.iter().any(|i| i == "UAA") { + stop_index_1 = inter_codons.iter().position(|r| r == "UAA").unwrap(); + } + if inter_codons.iter().any(|i| i == "UAG") { + stop_index_2 = inter_codons.iter().position(|r| r == "UAG").unwrap(); + } + if inter_codons.iter().any(|i| i == "UGA") { + stop_index_3 = inter_codons.iter().position(|r| r == "UGA").unwrap(); + } + + let stop_index = find_first(stop_index_1, stop_index_2, stop_index_3); + + return stop_index; +} + +//#[wasm_bindgen] +pub fn find_first(stop_index_1: usize, stop_index_2: usize, stop_index_3: usize) -> usize { + let mut stop_index: usize = 1; + + if stop_index_1 < stop_index_2 { + if stop_index_1 < stop_index_3{ + println!("UAA stop codon found!"); + stop_index = stop_index_1; + } + } + else if stop_index_2 < stop_index_1 { + if stop_index_2 < stop_index_3 { + println!("UAG stop codon found!"); + stop_index = stop_index_2; + } + } + else if stop_index_3 < stop_index_1 { + if stop_index_3 < stop_index_2 { + println!("UGA stop codon found!"); + stop_index = stop_index_3; + } + } + else { + println!("No stop codon found!"); + process::exit(1); + } + + return stop_index; +} + +//#[wasm_bindgen] +pub fn translation(inter_codons: Vec) -> Vec { + let mut amino_acids_list: Vec = Vec::new(); + + for i in inter_codons { + match i.as_str() { + "GUU" | "GUC" | "GUA" | "GUG" => amino_acids_list.push("Valine".to_string()), + "GCU" | "GCC" | "GCA" | "GCG" => amino_acids_list.push("Alanine".to_string()), + "GAU" | "GAC" => amino_acids_list.push("Aspartic Acid".to_string()), + "GAA" | "GAG" => amino_acids_list.push("Glutamic Acid".to_string()), + "GGU" | "GGC" | "GGA" | "GGG" => amino_acids_list.push("Glycine".to_string()), + "UUU" | "UUC" => amino_acids_list.push("Phenylalanine".to_string()), + "UUA" | "UUG" | "CUU" | "CUC" | "CUA" | "CUG" => amino_acids_list.push("Leucine".to_string()), + "UCU" | "UCC" | "UCA" | "UCG" | "AGU" | "AGC" => amino_acids_list.push("Serine".to_string()), + "UAU" | "UAC" => amino_acids_list.push("Tyrosine".to_string()), + "UAA" | "UAG" => amino_acids_list.push("STOP".to_string()), + "UGU" | "UGC" => amino_acids_list.push("Cysteine".to_string()), + "UGA" => amino_acids_list.push("STOP".to_string()), + "UGG" => amino_acids_list.push("Tryptophan".to_string()), + "CCU" | "CCC" | "CCA" | "CCG" => amino_acids_list.push("Proline".to_string()), + "CAU" | "CAC" => amino_acids_list.push("Histidine".to_string()), + "CAA" | "CAG" => amino_acids_list.push("Glutamine".to_string()), + "CGU" | "CGC" | "CGA" | "CGG" | "AGA" | "AGG" => amino_acids_list.push("Arginine".to_string()), + "AUU" | "AUC" | "AUA" => amino_acids_list.push("Isoleucine".to_string()), + "AUG" => amino_acids_list.push("Methionine".to_string()), + "ACU" | "ACC" | "ACA" | "ACG" => amino_acids_list.push("Threonine".to_string()), + "AAU" | "AAC" => amino_acids_list.push("Asparginine".to_string()), + "AAA" | "AAG" => amino_acids_list.push("Lysine".to_string()), + _ => { + // println!("Incorrect char"); + break; + } + } + } + + return amino_acids_list; +} + #[wasm_bindgen] -pub fn greet() { - alert("Hello, wasm-dna-transcription-translation!"); +pub fn main() { + println!("Enter the DNA strand to be transcribed and translated: "); + + let mut strand: String = "TACATGCCATACGAGACGAGCGCGCCTAAGCGGCGCAGACTCATGGTCATT".to_string(); + strand = strand.to_uppercase(); + + let messenger_rna = transcription(strand); + println!("The transcribed strand is: {}", messenger_rna); + let inter_rna = find_start(messenger_rna); + println!("{}", inter_rna); + let mut inter_codons = break_into_codons(inter_rna); + let mut stop_index = find_stop(&inter_codons); + stop_index = stop_index + 1; + println!("{}", stop_index); + inter_codons.truncate(stop_index); + let amino_acids_list = translation(inter_codons); + print!("The translated amino acids are: "); + for i in amino_acids_list { + print!("{}, ", i); + alert(&i); + } } diff --git a/www b/www new file mode 160000 index 0000000..9ac3dff --- /dev/null +++ b/www @@ -0,0 +1 @@ +Subproject commit 9ac3dff9ebea4675e5c478bcdcbc0fd547d1529f