Sample: TACATT Output: UAA STOP codon found The mRNA strand is: AUGUAA The codons are: ['AUG', 'UAA'] There are 2 amino acids translated from this mRNA strand. ['Methionine', 'STOP'] Working as intended?: Yes. Sample: TACATGATT Output: UAA STOP codon found The mRNA strand is: AUGUACUAA The codons are: ['AUG', 'UAC', 'UAA'] There are 3 amino acids translated from this mRNA strand. ['Methionine', 'Tyrosine', 'STOP'] Working as intended?: Yes. Sample: TACATGCCAATT Output: UAA STOP codon found The mRNA strand is: AUGUACGGUUAA The codons are: ['AUG', 'UAC', 'GGU', 'UAA'] There are 4 amino acids translated from this mRNA strand. ['Methionine', 'Tyrosine', 'Glycine', 'STOP'] Working as intended?: Yes. Sample: ATACATGCCAGTCATCGTTATTC Output: UAA STOP codon found The mRNA strand is: AUGUACGGUCAGUAGCAAUAA The codons are: ['AUG', 'UAC', 'GGU', 'CAG', 'UAG', 'CAA', 'UAA'] There are 7 amino acids translated from this mRNA strand. ['Methionine', 'Tyrosine', 'Glycine', 'Glutamine', 'STOP', 'Glutamine', 'STOP'] Working as intended?: No. Doesn't recognize first stop codon. Sample: TACATGCCATACGAGACGATT Output: UAA STOP codon found The mRNA strand is: AUGUACGGUAUGCUCUGCUAA The codons are: ['AUG', 'UAC', 'GGU', 'AUG', 'CUC', 'UGC', 'UAA'] There are 7 amino acids translated from this mRNA strand. ['Methionine', 'Tyrosine', 'Glycine', 'Methionine', 'Leucine', 'Cysteine', 'STOP'] Working as intended?: Yes. Sample: TACATGCCATACGAGACGAGCGCGCCTAAGCGGATT Output: UAA STOP codon found The mRNA strand is: AUGUACGGUAUGCUCUGCUCGCGCGGAUUCGCCUAA The codons are: ['AUG', 'UAC', 'GGU', 'AUG', 'CUC', 'UGC', 'UCG', 'CGC', 'GGA', 'UUC', 'GCC', 'UAA'] There are 12 amino acids translated from this mRNA strand. ['Methionine', 'Tyrosine', 'Glycine', 'Methionine', 'Leucine', 'Cysteine', 'Serine', 'Arginine', 'Glycine', 'Phenylalanine', 'Alanine', 'STOP'] Working as intended?: Yes. Sample: TACATGCCATACGAGACGAGCGCGCCTAAGCGGCGCAGACTCATGGTCATT Output: UAA STOP codon found The mRNA strand is: AUGUACGGUAUGCUCUGCUCGCGCGGAUUCGCCGCGUCUGAGUACCAGUAA The codons are: ['AUG', 'UAC', 'GGU', 'AUG', 'CUC', 'UGC', 'UCG', 'CGC', 'GGA', 'UUC', 'GCC', 'GCG', 'UCU', 'GAG', 'UAC', 'CAG', 'UAA'] There are 17 amino acids translated from this mRNA strand. ['Methionine', 'Tyrosine', 'Glycine', 'Methionine', 'Leucine', 'Cysteine', 'Serine', 'Arginine', 'Glycine', 'Phenylalanine', 'Alanine', 'Alanine', 'Serine', 'Glutamic Acid', 'Tyrosine', 'Glutamine', 'STOP'] Working as intended?: Yes. Sample: TACAGGCCTTAGATCGTCATGCCATACGAGACGAGCGCGCCTAAGCGGCGCAGACTCATGGTCATT Output: UAA STOP codon found The mRNA strand is: AUGUCCGGAAUCUAGCAGUACGGUAUGCUCUGCUCGCGCGGAUUCGCCGCGUCUGAGUACCAGUAA The codons are: ['AUG', 'UCC', 'GGA', 'AUC', 'UAG', 'CAG', 'UAC', 'GGU', 'AUG', 'CUC', 'UGC', 'UCG', 'CGC', 'GGA', 'UUC', 'GCC', 'GCG', 'UCU', 'GAG', 'UAC', 'CAG', 'UAA'] There are 22 amino acids translated from this mRNA strand. ['Methionine', 'Serine', 'Glycine', 'Isoleucine', 'STOP', 'Glutamine', 'Tyrosine', 'Glycine', 'Methionine', 'Leucine', 'Cysteine', 'Serine', 'Arginine', 'Glycine', 'Phenylalanine', 'Alanine', 'Alanine', 'Serine', 'Glutamic Acid', 'Tyrosine', 'Glutamine', 'STOP'] Working as intended?: No. Doesn't recognize first stop codon.