From cec1533fba7edd5db5d1fac8c9004bdad71a7042 Mon Sep 17 00:00:00 2001 From: rav4s Date: Sat, 7 Nov 2020 15:13:35 -0600 Subject: [PATCH] Added some samples with program output, along with if they are working as intended or not --- sample_strands.txt | 74 ++++++++++++++++++++++++++++++++++++++++++++++ 1 file changed, 74 insertions(+) create mode 100644 sample_strands.txt diff --git a/sample_strands.txt b/sample_strands.txt new file mode 100644 index 0000000..4760e6d --- /dev/null +++ b/sample_strands.txt @@ -0,0 +1,74 @@ +Sample: TACATT +Output: +UAA STOP codon found +The mRNA strand is: AUGUAA +The codons are: ['AUG', 'UAA'] +There are 2 amino acids translated from this mRNA strand. +['Methionine', 'STOP'] +Working as intended?: Yes. + +Sample: TACATGATT +Output: +UAA STOP codon found +The mRNA strand is: AUGUACUAA +The codons are: ['AUG', 'UAC', 'UAA'] +There are 3 amino acids translated from this mRNA strand. +['Methionine', 'Tyrosine', 'STOP'] +Working as intended?: Yes. + +Sample: TACATGCCAATT +Output: +UAA STOP codon found +The mRNA strand is: AUGUACGGUUAA +The codons are: ['AUG', 'UAC', 'GGU', 'UAA'] +There are 4 amino acids translated from this mRNA strand. +['Methionine', 'Tyrosine', 'Glycine', 'STOP'] +Working as intended?: Yes. + +Sample: ATACATGCCAGTCATCGTTATTC +Output: +UAA STOP codon found +The mRNA strand is: AUGUACGGUCAGUAGCAAUAA +The codons are: ['AUG', 'UAC', 'GGU', 'CAG', 'UAG', 'CAA', 'UAA'] +There are 7 amino acids translated from this mRNA strand. +['Methionine', 'Tyrosine', 'Glycine', 'Glutamine', 'STOP', 'Glutamine', 'STOP'] +Working as intended?: No. Doesn't recognize first stop codon. + + +Sample: TACATGCCATACGAGACGATT +Output: +UAA STOP codon found +The mRNA strand is: AUGUACGGUAUGCUCUGCUAA +The codons are: ['AUG', 'UAC', 'GGU', 'AUG', 'CUC', 'UGC', 'UAA'] +There are 7 amino acids translated from this mRNA strand. +['Methionine', 'Tyrosine', 'Glycine', 'Methionine', 'Leucine', 'Cysteine', 'STOP'] +Working as intended?: Yes. + + +Sample: TACATGCCATACGAGACGAGCGCGCCTAAGCGGATT +Output: +UAA STOP codon found +The mRNA strand is: AUGUACGGUAUGCUCUGCUCGCGCGGAUUCGCCUAA +The codons are: ['AUG', 'UAC', 'GGU', 'AUG', 'CUC', 'UGC', 'UCG', 'CGC', 'GGA', 'UUC', 'GCC', 'UAA'] +There are 12 amino acids translated from this mRNA strand. +['Methionine', 'Tyrosine', 'Glycine', 'Methionine', 'Leucine', 'Cysteine', 'Serine', 'Arginine', 'Glycine', 'Phenylalanine', 'Alanine', 'STOP'] +Working as intended?: Yes. + + +Sample: TACATGCCATACGAGACGAGCGCGCCTAAGCGGCGCAGACTCATGGTCATT +Output: +UAA STOP codon found +The mRNA strand is: AUGUACGGUAUGCUCUGCUCGCGCGGAUUCGCCGCGUCUGAGUACCAGUAA +The codons are: ['AUG', 'UAC', 'GGU', 'AUG', 'CUC', 'UGC', 'UCG', 'CGC', 'GGA', 'UUC', 'GCC', 'GCG', 'UCU', 'GAG', 'UAC', 'CAG', 'UAA'] +There are 17 amino acids translated from this mRNA strand. +['Methionine', 'Tyrosine', 'Glycine', 'Methionine', 'Leucine', 'Cysteine', 'Serine', 'Arginine', 'Glycine', 'Phenylalanine', 'Alanine', 'Alanine', 'Serine', 'Glutamic Acid', 'Tyrosine', 'Glutamine', 'STOP'] +Working as intended?: Yes. + +Sample: TACAGGCCTTAGATCGTCATGCCATACGAGACGAGCGCGCCTAAGCGGCGCAGACTCATGGTCATT +Output: +UAA STOP codon found +The mRNA strand is: AUGUCCGGAAUCUAGCAGUACGGUAUGCUCUGCUCGCGCGGAUUCGCCGCGUCUGAGUACCAGUAA +The codons are: ['AUG', 'UCC', 'GGA', 'AUC', 'UAG', 'CAG', 'UAC', 'GGU', 'AUG', 'CUC', 'UGC', 'UCG', 'CGC', 'GGA', 'UUC', 'GCC', 'GCG', 'UCU', 'GAG', 'UAC', 'CAG', 'UAA'] +There are 22 amino acids translated from this mRNA strand. +['Methionine', 'Serine', 'Glycine', 'Isoleucine', 'STOP', 'Glutamine', 'Tyrosine', 'Glycine', 'Methionine', 'Leucine', 'Cysteine', 'Serine', 'Arginine', 'Glycine', 'Phenylalanine', 'Alanine', 'Alanine', 'Serine', 'Glutamic Acid', 'Tyrosine', 'Glutamine', 'STOP'] +Working as intended?: No. Doesn't recognize first stop codon.